EST 1381673 is a singleton


Sequence

>1381673 (1 EST) Length=591 NTTTTTTTTTTTCCTTTTCCCACCATGTCATCTCGTGCCACTGGGGTCTTATTGGCCACCCCTCCTGCACGCCTAAACTG TACTCCTCTGCATACTTAAGTCAGAAGCCAGAACACACAACAACACACAAGAGCCCCACCGCAGAGCTAAAGAGAAACGT GCCAAACACCGTGCGTGCGTGCGTGTGAGAGAAAGAGAGATAGAGAAAGGTAAAAAGAAAAAATATAGATAATCCCAAAA ATAATTTTCTCCAGGCGCCTCCAGAAGCATACCCCTCAGTAGAGCTTGAAATTGTCTCTTTCCGCGCAGGATGCCTCCTC ACCAAACTACTCTCCATTTCTACACCCACCTCCCGCACCGAAAGGTCGGGCTTGTGCACCTCCACAGTCATCGCATGCAT TAAAAGGGAGCATTTTTTTAAAGTGGGTAAAGGGAGTTTGTCATGGCCGTGACGTGTACTCTGCCTTTCCTGAAGGTTCT TCTCTCAAGCAGAACGGGTAAGTGACCCTTTTCTTCCTTTTCCTCGTCTCAGGTCCGCCTCTGATCTCTGAGTTCCCTAG GAAAGGGGCAAGGGCCGCTAATACCCCAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1381673: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816732655751AA676087TENF0619T.cruzi epimastigote normalized cDNA Library


Date: 0:57:0 on Fri 24 Nov 117.