EST 1381679 is a singleton


Sequence

>1381679 (1 EST) Length=617 CCGGTATCTGTGGAAGGAGACGATGAGGTTGCCGCCAGCTCCCTGTTGTACAAAAGTGCTGTACAACCGCCCGTTGAGTG ACAATGAGATCGCCGCCTTCAATCCGAATAAAGTCACCATTCAACAGTTGAAGGATAAGTCGTCGGAGCCTTCACCAGTT TCTTCTGATTCCTTTAATCCTAACGCCTCTCCGGTTACCGCAGCTGCTCAGCAAACCGGAACTTCGTCAACTCCCGACGG AACACATCCGACGGAACAGAGACAGTCGATGGGGAGCAGTAATGCGGGCAGTGGCGGTGCATCCACAACAGCAGTGTCCA CTATAACTACTCCTGCAGCAGGAGAGGAGCCCGTAGTGCAGGTGGCGTCAGGATCATCTTCTGATGGACATAAAAATGTG GGTGGCGGTTCTTTTTCTGATGGCAACCCAACGGTGGGAGACAAGAGAAGGAGGAACGAATGGGCAGGAGGAGGAGGTTA GTCCCAGGTCAGGGGAATGAATTCCACGGGACTCAACAGCAGCCTCGGGAATTTGTCGAAGGAATAACAGTGTCCGGACC ATTCGTGGACGACTGTCATCGTGTTTGCTTTTGGACTTGGCTTCGGCTTTAGGGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1381679: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816792655757AA676093TENF0625T.cruzi epimastigote normalized cDNA Library


Date: 8:42:8 on Mon 20 Nov 117.