EST 1381680 is a singleton


Sequence

>1381680 (1 EST) Length=324 ATTTAAATCCCGATTATACAGCTTATTTTGCCAATTATACAAACAAGCACCTAACAAATAAAAGAATTTTACACACAGAT AATCAAACGAAAAGCAACTTTGAGAAAATGAAAAAACAAAGAAAACAGTACCAAATAAATAACAGGAAAAGGTTCTCCGC GCGATAAATACCTTCAACACACCACCTTTTTAAACAGAAAAAGACACCAAACTGACGTGCCCGCGCCGTCGCCAATGTAA ACACCGTGTCCGCATGCGGCGGGGCACCTGTTTTTGCTGGGCGGACACATTCTCCACTTTATGTAGTTGATGGTCATTTT TAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1381680: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816802655758AA676094TENF0626T.cruzi epimastigote normalized cDNA Library


Date: 16:19:54 on Fri 17 Nov 117.