EST 1381687 is a singleton


Sequence

>1381687 (1 EST) Length=422 GCTTCCTTTATTCCTACTTCTTCTTGCCACCTCCCTTTGCTGCCTCCTTATCCCGTACCTTTTTGAAGACGATAAGCTGC TCCCACTTGTAATCATCGATAGCCAACGGGTTCAGGACACGTCCTTCTGCCCCCATGCGGTCTGCGGCAAGCCACGCCTC CTCCATCACCATCTGAATAAGGTCATGGGAACTCGTTCCCTCCAGCAAAGGAGGCACGTACGTTTTGCCATTGAGCCACG TCACCTCAATGCGTGGGGTAATGTGATCAATGGCGTAAAACAAAAACACTTTATCCTTCGGAAAAGGTGCCCGTGCGCTA ATGGCACGCCGGTAGAAGTCCATCAGCGGCTTCTGCAACGGGTGGTCCATAACCGAAAAGAAATGGGGGAGATGGTGATG GGTTAGCCTTCTCCATGTGCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381687: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816872655765AA676101TENF0634T.cruzi epimastigote normalized cDNA Library


Date: 0:28:34 on Fri 24 Nov 117.