EST 1381710 is a singleton


Sequence

>1381710 (1 EST) Length=483 GATGCTGCAGGAGATGTTACAAGCATCCGCCACAAAGTACGGCGGTGTGTACTATATAAGTGCTCTGCCGGCAAGCCGCA ACACTCTTCTTTATCCTGCGCACGCTACCCGTTCTCATACCGGCGCATCTGCTCTTTCTTCAGTCGCCACAACTGCCGAG TTGGACTACTGGAAGTATCTTCAAGCCTTACAAGATGTCTTTTACCGCTTTGCTGAGCTGCGTGATCTCTGTTGCACCGG ATTTTCAAAAGAGCACTGCACGCATCACGTTTTCTTTTTACGCATCACAGAACACCCTCGATTGAAGGATCTCATGGCGA TGCTGGCCATTGAAAATTCTCGTCTGTGCTTCTGCCTGTGCGCTTTCTTCAAGGGTGGCACAACAATATTTAAGCAGCGT GCGCAGGATGTTGGGGGGTGGAATGGAATGGGTTTTGGGGTCCACGTTGGTGAACGGGGCCANAAAAGCTGGCGATGACG GAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381710: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817102655788AA676124TENF0673T.cruzi epimastigote normalized cDNA Library


Date: 7:23:24 on Sun 19 Nov 117.