EST 1381713 is a singleton


Sequence

>1381713 (1 EST) Length=463 CTTCCTGCGATACGGTACTATCTTTTTAACTCTGAAGCATCCGTTTAACGTTATGAGTACATTGTTCACGGCTTACTGGT GTAACAAGGCCGTGACACAGCGGTGAGTAGGATCGGAAGAAGGAGAATTGAAATGGATGGAATTTTCCTTCTTTTTTTTT TTGTTTTTTTGTTTTGTTTCCCCTTGTGTGTTCTTTAGAAGTAACATGGTGAGTGCGGTTTTGTATGGACATGAAATATA TTTAAAAATAAATATACATACATATATATATATAAAAAAAAAGGTGTGAATAGATAAATATTGCGTGTGTGTGTGTATGT GTATGTGTGTGGGTACAAGGGTTAGGAGAACACCCCTGCACTGGGGGGATTGAGTCGACATGACGGCTCTAATTTTCCTG TGGGTGCCGGTATTTTGCCCTTTTACCCCTTTTAACCGCGCAGCATGAGTGAGGCACCGCAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1381713: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817132655791AA676127TENF0677T.cruzi epimastigote normalized cDNA Library


Date: 20:13:14 on Sat 18 Nov 117.