EST 1381716 is a singleton


Sequence

>1381716 (1 EST) Length=445 GAAAACGAACAACAAAAGACAAGAACGGGACAACTCAGCAGGGCCGCAGAGAGAGAGAGAGATGAATGGACAGGCGGCAG AGAGTGGTGGCGGTGGTTCCATCAACATCACACAACTTCCACTTGAGCAGCTGGAGGAACTGAGAAAACAGCTGCAAGTG GATGTTAACAACCTGTCGGTTGCCCACGAGAGCCTTCTCAGCGCACAGACTCGCTTTTTAAGCAATTGCGAGGTGTTGTC GGAGTACCAAAAGGTCTGCGAGGCGGCCCGCGCAAGTCCGGAGAAACAGCCGGAGTCTTTCTTTGCATCAGCAGTGCCCT TTATGCGAGTGGCCGCATCGTGCCGAGCGATCGCCTGCTGGTGGACGTTGGAACGGACTACTTTTTGGAGAAGTCGATGG GGTCCGCTAGGTCGTACTTCGCTGGCCGGTCCGACGCGGTGCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1381716: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817162655794AA676130TENF0681T.cruzi epimastigote normalized cDNA Library


Date: 11:20:41 on Sun 19 Nov 117.