EST 1381718 is a singleton


Sequence

>1381718 (1 EST) Length=465 TGACAATCTATGACTCTTTTATTCCGTACTTTTGCCGCTGTGCAACCCATACAGTGGTTTGTTTCTTTGTGATTGAGTGT TTAACGCGAAACGCAAAATTGTGGCGCAGTTCCAGGCTAACAAAGGAGAGCTCTTTTGGCTCTCGTCGTGTTGACGTGCC TGCGTGAGTAGGGAAGAGGGATGAACGGCTGGGGCGGGAAACAAAGAACAAAATAATTTTTTTGTTTACGTCGGATTGGG CGAATGGAGCGGATGAGGGAGGACGTTACCCGCAGAATTGTGAGATTTGTTCCGTTTCATTCAATTTTCCTTTACCGCAA AAGTGAGTGATCAACCAACGGCCATAGACCGAAAATAACAGAGGACAAGGGATGACTCAGAGCACAACACGGTACCAGGA TTGGATGGAATTGCAAGCCCATTTAAATTAAAACCGGAAAATGNAAAATCGCGGTTTTAAAGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381718: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817182655796AA676132TENF0683T.cruzi epimastigote normalized cDNA Library


Date: 9:50:33 on Thu 23 Nov 117.