EST 1381720 is a singleton


Sequence

>1381720 (1 EST) Length=456 CCTCATTCAAAACTGCGCCGGGGCTGGCACGAATGACACGTGTAATCCTCCATTTAGTGCCATGCTGACAATTGCCTCAC GTGGGGATCTGAACCCAGCAGGGGATGCGAAGAACTACGGCCCACTGTACGAGTACCTTGGCCGCCGTGACCACGGTGCC ACCGATGCGAAGATTGCCACGTGGAGTGGAATGGTTATGGATCTCCACCACTACACCTCCCATGTCATCTGCGGCCCCAC AAATGAACAGCAACCCACATTTGAATGGAAAGATGACTTGTTTACGCCCATGCCGCCCACATACGGTCTACCAAAGGTGT ACAACTTCACATTCATGACATACGTGACCAATGTCTCTCCAAAAAGTCCGGGTATTGAGAATGCAAGAAATAAATGGGTC GGTATTGCTGTCAGCACTGCAGGCTGCGGCGTTGGTTTTTGTTTCCAATTGGGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1381720: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817202655798AA676134TENF0685T.cruzi epimastigote normalized cDNA Library


Date: 9:46:9 on Fri 24 Nov 117.