EST 1381721 is a singleton


Sequence

>1381721 (1 EST) Length=492 GGACTTTCGGTGCCCGGTGACGTTTTGCGAGGCAACAAAGGGAGAAGGAGCACAAAATAATTGGTTCATTGAGGGAGAAG ATCAGCGATGGTGAAGGGTGACTGCATACGGGCGGCCCACCTGCTCATCAAGTTTGATGGGAGCCGTAACTGCGTTTCTC ACCGGACAGGGAAGAGCACCGCAGATCTCACGTACGATGCGGCGCTTGCTGAACTGAAGCAGTGGGCGAAGAGGATAGCG GATGGCGACATAACATTTGAGGATGCGGCCCGCCAGCGCAGTGACTGTGGCAGCTACAACAGCGGCGGCGACTTGGGGTT TTTCGGCCCCGGTGTGATGATGAAACCGTTTGAAGACGCCGCTCGTTCGCTGAATGTGGGAGAAGTCAGCGGTGTTGTGC GGACAGAAAGTGGTCTCCACATTATCAAGCCGGCTCGCGTTAGGATTGTTGCTACCGTTTTGCCCCTTGAAACGGTTGAA GACCGATTGGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1381721: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817212655799AA676135TENF0686T.cruzi epimastigote normalized cDNA Library


Date: 19:21:47 on Thu 23 Nov 117.