EST 1381722 is a singleton


Sequence

>1381722 (1 EST) Length=460 CTCTAACACACAAACAAAAAAAAAAAGAAAAAAAAGAGGAATTGTGTTTCCTATGAGTCGGCCTTTCGCTGTGGATGTGC TGTGTACCATCATGCCGCTTCTCCGGCTTTGCGTTTATTTTAGAACTCTGTCCCCTTTTTTTTGTTGTTGTCTTGGTGTG TGTCTGTCCGTCTGTTTCGGGGAACGCCACGTGAAAAGGCTGAGTTGGGGGGTTTGAGATTTCATTTTTTTGCGTCGAGG CGTTTTCACATTTAGTGCCTCAGGGTAGTCGGATAATGCAGCAAAAAAGCCATGTGCACTGTCCCGCAGCACTCGGGGGC TAAAATGGGCGACCTTACCGTGTGCCGCGACCATTGAAGAATAACACAACGGGGAGACGAGCACGGGGGTGTTTCCTGCC GTGGGAATTTTAATACGAATCCGTTTGGGGCATGTAAGGGAAATAACGTGCCGAGAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381722: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817222655800AA676136TENF0687T.cruzi epimastigote normalized cDNA Library


Date: 6:47:33 on Sat 25 Nov 117.