EST 1381732 is a singleton


Sequence

>1381732 (1 EST) Length=414 GTGACATTTACGAGTGCCGCGTCAATGGGATTCATGCTCATAACGCTTGTGTCACCGCTGGCAACAATCGCATTCGTGAT GTCCTCTTTGGCATTTACTTTCGCGGACAATCAACAGGGGCTATGGAGAAGAACTCGATAGAGCATGTTAGAAAGTTTGG CATTTACGTGACGGAGGGAAGTGATCCGGTGGTTCAGGGGAATCAAGTTCGGGAGTGCGGAATGCACTGCGCCTTTGTCT CTCAGGGCGGTAAGGGAATTTGGACAGAGAACAATTTTGAGGGCTCAATGCATGTGCTGACTGGCTGTGCTGCCAAGTTG GGTTCCAACCAAATTAACGGTAAACTTGACGTGGACGTTGCGCCCCGTCGTGGCCTAGTCTGTTTTCTGCGGAAGAGATC CGTTTGACTTAGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381732: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817322655810AA676146TENF0703T.cruzi epimastigote normalized cDNA Library


Date: 1:50:21 on Sat 18 Nov 117.