EST 1381733 is a singleton


Sequence

>1381733 (1 EST) Length=459 GCGGCGCTTCACGCCACGCATACCTTCTGCAGCATCCGGGTGCGGTCGGAGGGGAGCATTGCGCAATGTATTGTTCCCTG TTTGGCTGGGAAAGGGCGTTGGCGGTTTGGTGCCGCCACTTTCCGCATCAGATGCTGCGCGAGGTGTCGGGCCACGCAAA AGGACTGGAGTACTGTATGCAATCTCTTGAGTGCGCTCTGGAGTAAATACAAAAGAGAAAAAGAAACTGGTACAGTAAAG TGGCATGGAGAGAGGGGATTTGCGCGCGGGCATCAGAGGACCGATAGAAAATGTAAGAAAAATTTTCCGTCCATGATAGG AGTCTTTTTTTCTCCTGTACATATTTGGTTTTTTGTTGTTGTTTTTTTGGATACCCTTGCACCTACACTCACTCCACATT TGCCCTTTTTAATTGGGTTCCTTTTGGGGGGATATCTGCGCAATTACCCCCTAACACGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381733: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817332655811AA676147TENF0705T.cruzi epimastigote normalized cDNA Library


Date: 1:9:41 on Mon 20 Nov 117.