EST 1381736 is a singleton


Sequence

>1381736 (1 EST) Length=424 ACGCCTCCACGAGCAAAGAGACGCGCTGTGCACTGCTCAACGTCATCCATGAACTTCTCCTTACGTGTGCTGCCAACGGT GTTCCAGAGGCAGGGAAGCGGAGTGTGCTGATGGCGGTTAGTAAGACCCTTCCTGGCATGGTGCAGGCGGTGCGCGGAAT TGCTGGGGCAGACGCCGAGGCGTTTGAGCAAAATCTGTCAAAGGTGGTGTCATGGTGGTCGATGCTGAATATTTTCCCAC GTGCATGGATCGCCCAGCTTGGTGTGAAAAAGGAGGCGGACAGCCTAGAGATGCGACAGGAGGGGCTTCAATGCCCGTGC AGCTTTCCTACATTGCGAACCTGATGTCGAGGTTCAACGAGATGAAGGAAGAATGTCTTCGAGTTTCACATGCCTCACCG GAACAACCGGGGTCTCTTCGTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1381736: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817362655814AA676150TENF0708T.cruzi epimastigote normalized cDNA Library


Date: 10:28:40 on Mon 20 Nov 117.