EST 1381737 is a singleton


Sequence

>1381737 (1 EST) Length=467 GTTTCTGTACTATATTGTACTGTCTGCGAGAGAAGCGGATTGGAGACACAGTAACGGTAGGAGCGGCACAGTAGCAGACG AAAACAGGTAAAACTCACACACAGACACGTACATTTTTATACGAGAGAAGGATGCCTCCAAAGAGAAGCCCTCCCAATCT GAATCACTTCATGGAGAAGCGGGTGGTGGTGAAGCTTCAAGGCGGTCGTTCCATCTCCGGTGAGTTGCGTGGCGTTGATA ATTTTCTGGGTGTTGTTCTCTTTGACGCCACGGATGAAAGACCTTCCTTCAACAATGAAGAAAATATGGAGAAGGTGGCT CTGGGCACAACAGTTATCCGTGGAACCGCCATTGTAGAAATTGTAGGGTTGGAGGCATAATGAACGAGGTGTATTGCCTG TTAATAAATGAATGAGAGAACGTGACAAGCACACAAACAGCAACAAAAAACAACAAGGAGGTTGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1381737: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817372655815AA676151TENF0709T.cruzi epimastigote normalized cDNA Library


Date: 11:48:15 on Fri 24 Nov 117.