EST 1381739 is a singleton


Sequence

>1381739 (1 EST) Length=311 CTCGCCACATTGGGCACCATGTCCCAGAGACGGGAGCCAATACCAAACCACTTAGAGGGTGTGTAGGGAACCAAAGCCAT TTCCTTAAACTTACATGTGTGTCTGCAAAAAATAAAAACAAAATACACTGCCTATATCGGTTCCCTGTCCCTACAAAGTC GCGTTCTTCCCAAAAGATTCATAAAATAAAAAGAATAATAAGGAATGCATTTATTTATTAGGATGTACATACATTAATTA AGTTAGCCAGCTCTCACGCAAGCATTCTTCTCACAAGCTTCTAAAACAAAAATTCAGACCACAACGTGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1381739: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817392655817AA676153TENF0714T.cruzi epimastigote normalized cDNA Library


Date: 6:29:7 on Thu 23 Nov 117.