EST 1381751 is a singleton


Sequence

>1381751 (1 EST) Length=294 CTAATACGACTCACTATAGGGAAAGCTGGTACGACTGCAGGTACCGGTCCGGNATTCCCGGGTCGACCCACGNGTCCGAC CTGTNATGGAGGGCGACAAGCGCGCGTCCTGGAAAACACTGAGGGCTTCCGCACCACTCCATCCGTTGTTGCCTTCAAGG GCCAGGAGAAGCTCGTGGGCCTCGCAGCAAAGCGCCAGGCCATCACAAACCCGCAGTCCACCTTCTTTCCTGTNAAGCGA ACTNNTTGGCCGCCGCTTCGAGGACTCGAACATCCAGCACGACATCAAGAACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1381751: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817512655829AA676165TEUF0050T.cruzi epimastigote non-normalized cDNA Library


Date: 15:26:51 on Thu 23 Nov 117.