EST 1381766 is a singleton


Sequence

>1381766 (1 EST) Length=336 AGTTTCTGTACTATATTGAAGTATCACTGTAAAAAAAAAAAAAAAGTTATAATCCTCAAATAATTACTTGTTAGCAGCCA CAACATCGTAATCTAATCATCGGTATTCAACGCAAACGTTACCGGAGGGAAGGAAGAAAGAAAATGACTGAGGGGAAAAA NGTGNCCCTCAAGNTTGGCATCATTGGCTTTGGCCGCTTCGGCCGNTTGGCCTTCCGCGCCGCGCAACACCGCAACGGCA TTGAGNTTGTNGGCATTAACGGTCTGCTGGCCGCGGGTTTCNTGGCGTACATGCTGNGGTTTGNCTCCCCGNACGGTCGC TNCGGCGGCATGGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1381766: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817662655844AA676180TEUF0113T.cruzi epimastigote non-normalized cDNA Library


Date: 14:12:45 on Fri 17 Nov 117.