EST 1381768 is a singleton


Sequence

>1381768 (1 EST) Length=194 GTTTGCCATCCGAGCCCGCCGCAAGACGATCAACGAAAAGGACTTCCTTGATGCTGTCAACAAGGTGATCAAGGGGCACC ACAAATTCAGCGCCACGGCAAAGTATATGGTGTACAACTGAGACCAAACTGGAAAGAGAATGAGAAATCAATGAGGCCGA GACGGCAAAAAGCGGGGAGAGAAAACGAGGAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1381768: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817682655846AA676182TEUF0133T.cruzi epimastigote non-normalized cDNA Library


Date: 18:50:16 on Sat 18 Nov 117.