EST 1381769 is a singleton


Sequence

>1381769 (1 EST) Length=255 GTCTCATCTTGCCATTATTATGGAGTACGTGCCTGGGGGCTCGTTGCATGCCGTGATCAAGAACTTTGGGCGTATGAGTT CCTTAGTGGCACGGCGGTTCACAGTAGATATTCTGAATGGCCTCAGCTATTTGCACCGGCCTTGGTATTGTGCACTGTGA TGTGAAGCCGCACAACATGCTTTTGGGGATGGATTGGCGTATGCAAGCTTGTCGGACTTTGGGGTCGACCAATTCTGAAG GCAGCGGACATGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1381769: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817692655847AA676183TEUF0141T.cruzi epimastigote non-normalized cDNA Library


Date: 3:3:17 on Tue 21 Nov 117.