EST 1381772 is a singleton


Sequence

>1381772 (1 EST) Length=200 CGAATCTTTGTGGGTGATAGCTACACTTACTTTGCGGGAACTGTACTTGCTGTTGCGGGTGTGACAGGGCAGTATGGCAA AACCCTCATGCTGTTTTTTCTTCCGCAACTTATTAATTTTGCTCTTTCGCTTCCGCAATTGGTTCATTTTGGGCCTTGTC CGCCGTCATCGGGTTCCGCGTTGGAATGCAAAAAAGGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1381772: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817722655850AA676186TEUF0151T.cruzi epimastigote non-normalized cDNA Library


Date: 10:39:31 on Sat 18 Nov 117.