EST 1381790 is a singleton


Sequence

>1381790 (1 EST) Length=156 CGCGGAGCACAGAAAACCTTTGCCTACGTACGGTCTGCGGAAACCCCCGCAGATGGCGTGTCACGCTGTCGCGTGTCCAC ACACGAGGACCTGGCGAAGGAGTGGAACTTGCTAAGGGTAGCGGGCGGGTTTCTTGTTGNCTGGGATGGGCNCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1381790: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817902655868AA676204TEUF0290T.cruzi epimastigote non-normalized cDNA Library


Date: 4:35:52 on Wed 22 Nov 117.