EST 1386033 is a singleton


Sequence

>1386033 (1 EST) Length=584 ATTTAAGTCTATAAAAATTAAATCACCCGTCGAAGTAAAAGTCGAAAATTTAAGTGATAATGCAATCGAAACAACAACTT GCATCATTAAATCAACGTTTAAAAATATTGATAGATGAAAACGAAATGATAAAAAAGCATGAAGAACAGCTCTTTATGAC CAAAAATCAAATCCTTGCTAGAATTGATGTTTTAAAGAAGCAAATTAGTGGAGCTATGGATCATTATCGCATTATAGCGC ATTCTTGCCGGAAAAAAATTGAGAGGGAAGAAATTCTTCAAAATGAAATGTTAATGGATTTAAAAGAGAGAGTTGATAAA CTTAATGATATGTGCACAGATATTAATAATCAAGCAGATGATATGATAGTGACATTGAATACTTATAACGCTGGTAAAAG TGATGCATTATATATGATTACTGCATGTTCGGTTGATTTTATTCATTCTACAAAAGTATTACTGGTAACAACAAATTCAA TATCACCAAATACTATTAGCAAAAGGGAAGAAAATTGATAAGTCCTATCAACACTTTATGATTTCAAATAATGTTTAATG CTTAAATAAACAATGTGAGTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1386033: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13860332660395AA680447SWAMCA3019SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 21:44:11 on Mon 20 Nov 117.