EST 1386034 is a singleton


Sequence

>1386034 (1 EST) Length=592 CCGGAATCGTTTTTACTTTCNGTATAAGATGCTAGTTGAAGATTTTCCTGCATCCCTTTCGGATAAAAGGTTTCACAGGT CTTTTCATTTTAATGTATCTCTTTTTTAGAACGCAAGTATCTCCGATAAGAGAAATATTGGAAATTCGCCGTAATAACTT ATCTGGTGAATTGCTTGTGCTCAGAGATATTGAGAACAGTCCTAAAAAGGTTGGGTGGATTGGTGAGCCCGCCTTTCATC CACTGGCGCTTATTCGTGGTCCTAGCGGAACATTTGCCGTTTCAAAGAAGGTGGTGATTATTGGCCGAGACTCTGCAAAT TCGATTACAGATCTTGTAGTTCAGGAAAGCAATTACGTAAGCAGGTGTCATATTATTCTGTACCATACTGGTCAACAGAA TAGATGGAATATCAAAGTGAATGGGAAGAACGGTGTGCTCATCAATGGAATTATGTATGGACAGTCTGAACAGGCTCGAA GTATTCCATTTAGTGTCACACTGGACCGCCGACATCAATGTCACCTCACATCGGTCAAACGCAAAAGATATAAACTCGAT AAAACACATATCTCCCGCNACTCAGNATCNAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1386034: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13860342660396AA680448SWAMCA3020SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 11:45:17 on Wed 22 Nov 117.