EST 1386062 is a singleton


Sequence

>1386062 (1 EST) Length=323 CTGTGATGATTATCTGCTTTTCAAGCTTTGATTTCCTTAATTTGAATGTTTCATTTTCATTTCCTTTAATTCTAATGATT CATTCTCTGAAGTGATTGTCGATTTTCTTGAATCTCAAATCACTTCAATTTATTCACTTGTAAAAATTTACAAAATTAAA AATGCGCCTACTAGCCATATTGTTGTCAGCAATACAATGTATGCGTCTCTCGGCTTACTACGCTGAAAAGAGATGAATTT TCAGGAACGTGCTAATGTCATTTATGCACATCACTTTGTATGCAACAGAATTTTGCTTGTTGAAACAAGAAATTTGAAAT GAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1386062: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13860622660424AA680476SWAMCA3066SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:17:33 on Fri 24 Nov 117.