EST 1386072 is a singleton


Sequence

>1386072 (1 EST) Length=469 CGGCACGAGCGGCACGAGATTATTCAGTTGGTNAAGATATGATTGATAAAGTTATGGATCGTACTCGACATTTGGCTGAG AATTGTGATGGATTACAGGGATTCCTCCTCTTCCATTCATTTGGTGGTGGTACTGGTTCAGGTTTTACATCTCTGCTAAT GGAACACTTAACAATTAATTATGGTAAAAAAAGCAAGCTAGAATTTTCGGTCTATCCGGCACCGCAAATTTCTACATCTG TACTGGAGCCGTATAATTCCGTCCTTATGACTCATGCTACCCTTGAGATTGCTGATTGTTCATTCATTGTGGACAATGAA GCAATTTATAACTTATGCCATCGTAATTTGGACATTGATCGACCATCCTACCCAAATCTAAATCGTCTCATTGCTCAAGT TGTTTCGTCGACTACCGCTTCGCTGCGCTTTAAAGGTGCGCTAAACGTNNATCTGATGGAATTTCAGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1386072: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13860722660434AA680486SWAMCA3083SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 17:58:56 on Mon 20 Nov 117.