EST 1387062 is a singleton


Sequence

>1387062 (1 EST) Length=265 CTTTTCNATTCATCTACCTCTAGGGGGGGGTCAGTAACANATCCNCCGGCAGNNAGTCTTATCTCAAAGAACATTCCTTT TACGAAGAATCGTACAAGTCGTCAAGCTGGTTATGGAGGCGGTGATATTGGTGTCAGCGGTGGTCANACAACGCAAGGAG GTGCTTGCGATGCATGCTGCTTACCANGAGCANTGGGACAGTTNGGTCCACCTGTCGCACCCGGTTGACAAAGCCACCAT CGACCTCCGTGNTTCCCTGTTTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1387062: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13870622663002AA680997SW3D9CA515SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 12:35:15 on Sun 19 Nov 117.