EST 1387084 is a singleton


Sequence

>1387084 (1 EST) Length=599 GATATCAANCTTATCGATGCCNTCGACCTCGNANGGGGGGCCCGGTACCCANTTCGCCCTATAGTGAGTCTTATTACAGG TGGTGATACCATCACTCTACAACGCTATCAATGAGGTACATGATGCGGTAATANATGGTGTGCAAGTTTTTCGCATCGAG ACCGATTCAGCATGGACTGAACTGATGGACGTGCAAATTANCGTGACACCACCTAGTAAAGCACGTGAAAACCCCTTCAA AAGCATTTTCCGTAAGAAAAGACAGGACTTTTCCGGTTTGCCGGATTATTGCCATTGTGAACCGATCAAGATTAGTTGTC CTCCTGGACCAGCAGGTCCAGTTGGTGAACCAGGAAAGGATGGACCACCTGGACTACCTGGTCCTCCTGGAGAAGATAAC ACANTAACATACCCACCAATGGAATGTCCTCCTGCTGATACCACTTGTNTTAAATGTGAAGCAGGCCAGCTGGACCACCA GGAGTGAATGGTGANCCAGGACCGGCAGGACCCGATGGTTCACCAGGATTGCCNGGACCAGCCAGGAAAACNAAAGGTTA AAGCCTGGGACNACCNNGGGGCCAATCGGTGNATNCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1387084: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13870842663024AA681019SW3D9CA554SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 6:6:20 on Wed 22 Nov 117.