EST 1451264 is a singleton


Sequence

>1451264 (1 EST) Length=233 TAAACACGTAAGCACACCCACACTCACACATGTATGCCGCTATAATACGTCTTGGCAATTTATTGCGGCTCCACAAAAAA AAAAAAAAAACGTGTGGATATGTACGTTAATGGCTGTCAATTCATCTCCTTCTCCTTTTGTTCCTTCTCTCTCTCTTTTT TTTTTCTCTTTTATCCGTGAAGCTGAGAGGAAAACTACATTGCCGTCCACACGCCCCTCTCCTCCCCCCTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1451264: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14512642767049AA736292TENU0001T.cruzi epimastigote normalized cDNA Library


Date: 13:6:33 on Sun 19 Nov 117.