EST 1451265 is a singleton


Sequence

>1451265 (1 EST) Length=245 CTTATCCTGCTTCTGCCTTGGGAACTCTACATTGGAACTGCGTGCGTGCCAAACTACAGTGTCGCGGTCAGGCGTCCTCA TCAAAAAGAAAGAACTGCTCGGCCAGCAGAAGTCGGTCAAACATGTACGCAAGTTCCGCTTCGTAATCGACCTCATTCTC GGCGTTTCGCGCCGTTTCAATAAAAAGTAGTCGCAAGTCGCGACAAGTGAGGTGGTACGGGGCGTTGGCGAGGGCCTTGT AATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1451265: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14512652767050AA736293TENU0002T.cruzi epimastigote normalized cDNA Library


Date: 6:49:57 on Sat 25 Nov 117.