EST 1451267 is a singleton


Sequence

>1451267 (1 EST) Length=314 TGACAGGCGTGCCATCGTCATGCACAAACACAGCTCGGGCTGCCGTTATCTCCCCCGCAGCCGCACGCGTCATTGGCTCC ACACGCAGATGGAGATGAAGCGTGATGGGGAGCGACANAACACCCTTTTCCCTCGTCTATTCCCAAATAAATTCGATAAT CCGCACGCCAGCCACCATCGTCGAGCGCTTCCGCCCTACTCAGTGGGAATGTAAAAGAGAGCCCCTGCCCCCGGAGAGGG AGGTGCGGCGGAGACCGTGAAAGGCAGACCCGTTATGCATCGGCGAGGGGAATTTTGCCTTCTCTCCGCGTAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1451267: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14512672767052AA736295TENU0004T.cruzi epimastigote normalized cDNA Library


Date: 13:43:57 on Fri 24 Nov 117.