EST 1451268 is a singleton


Sequence

>1451268 (1 EST) Length=285 TGAACGTGTAAGGGCATGTATCCTTCTTACTACGACCCCCTCCTCCTGCCTTCTTTCCCCATTTGGCTTCCAGTACGCCC ACTCCTCTTCTACTCGGTGATGTCACCCGAAGATTTCATACACAGAGAGCTTGAGATGACCGTCCACAGATGGCGCACGC GGCGGCACAAGCGCGGCCGGGCAAATATGACGCAGTGAGTGCGGTGGCACTTTGTACGAAGTCGAATGTGTCGTCTCAAA GTCACGATTGTCGGGAAGCGTTGCCCGCTCAAGTGCTTGACGGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1451268: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14512682767053AA736296TENU0005T.cruzi epimastigote normalized cDNA Library


Date: 12:54:39 on Sat 18 Nov 117.