EST 1451270 is a singleton


Sequence

>1451270 (1 EST) Length=337 TCCGACCCGCTCTCATGAGTAAGTGAGATATGTTTGTGTGTGGGGAGAGGAATATAGTATTCATCGGTGCCTTTGATTTT CATTCTCCTCGCCTCTTCTTTTCCGTCAAATGAGTGCCGCGCCCGGCAACTCTGAAGAAGCGCCGCCAGAGCCAAAGATA AATGACCCGACGCGCGACAAAATATTGCCGAGTGGAGAAAGCGTCGGGAAGAGGACAACACTCGAAATAAAACTAGGAAT TTGCTTCAGAAATTCAAAAAACAGCACCTCCTGCACCATATTGCATACCTCCATAAGCGTTTTTCTGGAGACGTCGCGAA AACGCACAGTAGGCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1451270: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14512702767055AA736298TENU0007T.cruzi epimastigote normalized cDNA Library


Date: 2:54:42 on Tue 21 Nov 117.