EST 1453480 is a singleton


Sequence

>1453480 (1 EST) Length=250 TGAAGTTTCTTTTGTGCTTCCCTCTTTTCCAACTTCAATTGGGTTGATCAAAGGTGGAGTACGCAAGGTCTCGCACCGAC AAGGTCTCGGTTAAGTGTGCCACAATAATCGTGCATATCTCGTAGATGAGGCTGAGTGGTCCGTACGACAGCAGGGCTAA CTTGCATGCACGCAAACCAACGCCGGTAGTTTGCATGGATGGCATGTGCGTAGACGCCCAGGAACCGCGCCACAAAACTA GACTGTAGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1453480: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14534802772469AA738508TENU0017T.cruzi epimastigote normalized cDNA Library


Date: 16:9:3 on Tue 21 Nov 117.