EST 1453484 is a singleton


Sequence

>1453484 (1 EST) Length=267 TACTTTTCGCTCCACAGAGAAGAAACGACAAATCCACTACACGTTTTATTGGCGTGCCATCGCCTCCAGGCCGACGGAAG AAGGCGGATAGAGTCCACGCGCGCAAAACTGCTTTAGACGATCCACCATCTCCTGTGAAAGGCCTGCTCGTTCCACAAGA AAAGCCGCAACCTGCAGCTGCCGTTCGCGCACACTTACATTGGCTTCTTGTGGCATAGAATAAAAAAAAGATGCGCATAA CGGTGCCATCGACAGCATGATGTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1453484: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14534842772473AA738512TENU0021T.cruzi epimastigote normalized cDNA Library


Date: 5:45:13 on Sun 19 Nov 117.