EST 1453485 is a singleton


Sequence

>1453485 (1 EST) Length=268 TCCTCCTCTCTCTCTCTCTCTCTCAGCTTCTCCTTCACAGAATGCATCCGATAACGGCAGGGGGTGACACGCATCCATTT CTTTGCAGGTTATGAGGCGACTTGACTGTGGCCGAGGGAAAAATGAATACATCGAAGGATTTTGTTCAGGCAGCCCCCTT CAGGAGCGGGTTCACTCCTCCTGCACACGTCCCCCCATGTTGCAGTAAACCCGCCAAACATCACCGGCAATAGAAGAACA TGTCATTCATGCCGTCCCACCTTCCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1453485: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14534852772474AA738513TENU0022T.cruzi epimastigote normalized cDNA Library


Date: 13:52:5 on Thu 23 Nov 117.