EST 1453491 is a singleton


Sequence

>1453491 (1 EST) Length=297 TCACAGGCTCCTAAAAATAAAATTAAGAACAGCTCCCCAAAATGATACAAGTATTTTATTGCCCCTCTTCTTCCTGGCTC CTACTCCTGAAAGTAGCGTTTCTTTTGTCGCAGGGTTAAGCTGTTCCACTCCCTCGGTGCAATTGCCAGCCAATCCGTTT CTTCAAGCGGACCCACCGACGCTTCCAGTTGCCGCTGTCCCTCGCGTAAAAAACAAAGGTATGCAGTTGATTCCCAGGTG GCATCGGTGTTTTCTTCCTCCTCTTTACCAGTTAATTTTGAGAATGTCTGATGATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1453491: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14534912772480AA738519TENU0028T.cruzi epimastigote normalized cDNA Library


Date: 17:50:57 on Fri 17 Nov 117.