EST 1453492 is a singleton


Sequence

>1453492 (1 EST) Length=311 TGTGACTGCACCCAAACACACACGCAGAAAAAAAAAGAAGTCATAAACGCGCACTTCTCTTTCTTACCTTTACTTGTTAT TTCCCTCCCCCTCCTCCCGCCGTTGTGGCACACAACACACACCCGATTCCTCGCCACCCGCCGCAGCCGCAATGCCCCAT GTGTGCAGCCAAAAGGGCGTGCACGCATATGACGCCGCGCCGGCATAAAAGGAGAGGCTGCAAGAAACAAAAATAATGCC TGGTCGAACAACAAAGCATGATGCATGCAAATGAACACGTATTATCCATACAAGTGCTGTCAACAAGAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1453492: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14534922772481AA738520TENU0029T.cruzi epimastigote normalized cDNA Library


Date: 9:43:14 on Fri 24 Nov 117.