EST 1453497 is a singleton


Sequence

>1453497 (1 EST) Length=292 TCAAAGAGAACCGGGAGAAAAAAAATAAATAAAGATTGTTAAAAGGGTTAGGGTTCTTTGACTGCGGGGAACGGCAAATG CGAAAAGATGCGCTGGGGGCAACCACCGGCCAACAAACATAACTCCCCTCCCCCTTGCAAAAAGAAAAAAATAATAATAA ACACTCCCGCCACTAAAGAAAAAATACAAAAGAAAAAAAAAAAAGNGATTCATAGCCGAGTGCTTTACACACGTCAGTTC TGCTCTCCAGAGGCCAAATCGCCGNGAAAAAACACACTACAGCACCCCCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1453497: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14534972772486AA738525TENU0034T.cruzi epimastigote normalized cDNA Library


Date: 18:49:52 on Thu 23 Nov 117.