EST 1453503 is a singleton


Sequence

>1453503 (1 EST) Length=322 TCACGCTCCAGGTAAATGAAGTCAAGAAAAAGTAAGGGAGCATGTGAGAAATGAACCAAAGATGGAATTCCCGTTGATAT CATGCAATGGAATTTGTCGAATACCAGCTTTTAACACACGCAACGGTAAAATGCACTCTGCTAGAAAGTCGTCGCGAGTT TTTTTGTCCTCGTCATAAACTTGCACAACAAGTGTTGAAAGATCCCAGTCCTTCACATCCCACGAGAACTCACTGCCCAA GCCCTTGCCCCGCCATACCGGGTGGAACCCATTGTTGCGAATTGTCCCCGATGTCTTTCGGTCACTATTACCGTCTGGGC CC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1453503: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14535032772492AA738531TENU0040T.cruzi epimastigote normalized cDNA Library


Date: 0:56:0 on Wed 22 Nov 117.