EST 1453505 is a singleton


Sequence

>1453505 (1 EST) Length=291 TCAACAACAACAACAAAAAACACATCTCATTTCCTACAAGGTACCGTGCAGTAAAGTAAAATAAATTAAAAGAAAAAAAA AGGGGGGGGGGAAAAAGACAGAACCATAAAATGCATCCGATGCCGTTACTCTTCCGTCAGTCGATCAATGATTCTTTGTA TTTTTGTCTGATCATATACTTCCAGCTTGCCTGTACATGCAGGAACAATGGCAATCTCAATGTTGCTTTTGGTCAGTTCT TCTTCCATCACCTGCTTCANGGATTCGCACTGCAAGCGTTTCTGCCTCCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1453505: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14535052772494AA738533TENU0042T.cruzi epimastigote normalized cDNA Library


Date: 12:42:10 on Tue 21 Nov 117.