EST 1453507 is a singleton


Sequence

>1453507 (1 EST) Length=301 TAATCTTCTTTGGCGCTGGCCGAATCCTGAAATTTCCTANAGAAACCAAACAAGATAGGGGAAAAGAGGTTTATCGCAGA GTTAGTTAATCGCCTCAATGGTTCCTTTTTATCCAATCAATAAATTCTATTGACCATTCGCATGGTATTTTGTCCTCAGC TAGAATCTGAAAGATAATTACTTACGAAGTGGCAGGCTTTGGGGTCTTCCAGCCACAAGACCCCGCCGCTCCCCTTAGCA AGTCCCACCCCTTCGCCAATTCCTGAAGTGTAAAAACACGACCGCGTGATAGGCCGTCTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1453507: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14535072772496AA738535TENU0044T.cruzi epimastigote normalized cDNA Library


Date: 11:54:45 on Thu 23 Nov 117.