EST 1478573 is a singleton


Sequence

>1478573 (1 EST) Length=262 GCAAGACCCAAGAGCTGAAATTTTGGCAGCTCGTGCATGTAAACAGCCTCAAGAATCTGTCTTCGATAACAGTGAACCTG TTGGTGCTAATTATAAACGACCAGATGTTCAGTCGGAAATTCGTTCTATTAAAGCCGCGAATAATTCAAATACTTTATCA TCAACAAATGAAAAGTCTGATATTAATAATAATTTAAATAGTCAAGACCAGTTATCATATCAAAATGGTTATCATCATCA TCAGTGCTCTTTACAACAATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1478573: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785732804069AA756899MF4MA141.AF3S. mansoni female adult Lambda Zap


Date: 13:48:6 on Mon 20 Nov 117.