EST 1478574 is a singleton


Sequence

>1478574 (1 EST) Length=239 AAATCATATGTCTAACGCAGATTCATCAAAAGGTCCAACACCTAGTTATCCAGTTTTCACTCCAGATTTCGTATCTTATT TCTTAGAGCGTGAAAGGAAAATTACCGAAGTTTCAAAACTTATTGCTACCTTACAAAATACGCAGCGTGAACTACAAATA TCAGATGCTAGTGCTTCACATAGTTATAATTCGGTTTCAACGGAGTTAGAAAAATTAAACAGTAGCCGTGGAAGCTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1478574: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785742804070AA756900MF4MA142.AF3S. mansoni female adult Lambda Zap


Date: 14:18:27 on Mon 20 Nov 117.