EST 1478580 is a singleton


Sequence

>1478580 (1 EST) Length=213 TCCAAGGACTGTAGCGGATTTGTATTTGGTGGATAGCTGTTTTCGTTTAACCTTATCGAATTACGCTTTCTTCTTAAACC ATCTTTATGGACTATATGTGAATATATTAACTATTGAGCTAACTATAGCATGAGCTTTAAGATACATCGTGTATGTCCAT TCTATAAACAACATACTTGATATTATGATATTATTCTGTGATGTATGATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1478580: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785802804076AA756906MF4MA148.AF3S. mansoni female adult Lambda Zap


Date: 10:37:44 on Sat 18 Nov 117.