EST 1478581 is a singleton


Sequence

>1478581 (1 EST) Length=217 TTACGCAGTACGGTAATGCAGCTGCTGGCATGTTTTTTTTTTTTTTTTTTTTTTTTTTGCAAAAAAGGAATGGTTTTTTA TTTGCACAGCCATTAAATTTTTCCCAAGTTTTAGTACAGAAAATGCATTTTTTTTAATTATTATTATCAAATAATAAATT CATAGAAAAAGTCATGNAACATAAAAATACATGCAATGAATATATTCATAGAATAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1478581: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785812804077AA756907MF4MA149.AF3S. mansoni female adult Lambda Zap


Date: 11:42:21 on Fri 24 Nov 117.