EST 1478582 is a singleton


Sequence

>1478582 (1 EST) Length=204 TTACGCAGTACGGTAATGCAGCTGCATGGATGTTTTTTTTTTTTTTTTTTTTTTTTTCAAGTCAAAACTTTATATTAACA AAATGAAAAATAACATATAAAATAAACATACAAGTATCGTTAAAACTAAACACGATTTACAAAATACTTAAATNGTATTA TGGATTGATTTGTACTAAGTTTTCGTCTACTGCTGATTACCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1478582: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785822804078AA756908MF4MA150.AF3S. mansoni female adult Lambda Zap


Date: 0:21:29 on Thu 23 Nov 117.