EST 1478583 is a singleton


Sequence

>1478583 (1 EST) Length=223 CTCGTGTTTTGCTTACAATTGCAACCTGAGTTTGTCATACCACTACCTCTATATCTTTGCAGCAATAAACTCCAATTTAG TTAGCGGTTACAAACGTTTCTTATTCAAGTTCGTTTAACTTAGTTCTATCTTGGACTTTGCACAAATAGTCGACTGACGC CGGAATATTCTGATGTACACTTTCTACGAATCTAATATTTCACTCATGATGGAGAATTCGTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1478583: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785832804079AA756909MF4MA151.AF3S. mansoni female adult Lambda Zap


Date: 12:34:59 on Sun 19 Nov 117.