EST 1478584 is a singleton


Sequence

>1478584 (1 EST) Length=204 ATTTTAAGTGGTGTTCATTTTGAATATGATCCATATTTATTAGAAAAGCAACTATACAATGTTGATCNTAAGAATAATGA CAATGTTGCTACCCTAAAGAATTATGAATTTATTGAAACATTGAAAACAAATAATTCGATCCCGTTTAAAATTATTTGAN ACTTTAATTACACTTTTATTGAATCNTGATAATAATTCAGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1478584: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785842804080AA756910MF4MA152.AF3S. mansoni female adult Lambda Zap


Date: 23:24:27 on Mon 20 Nov 117.