EST 1478585 is a singleton


Sequence

>1478585 (1 EST) Length=253 GTTACGCAGTACGGTAATGCAGCTGCATGGCAGTTTTTTTTTTTTTTTTTTTTTTTTTTACAAGCAAAAAGTATATTTTC ACGAAAAAAGAATATGTAGGTCAGTACTATGAATGGTTACCACAAATGTACAAACGGTGAGCCAAAATATTATTAAGGTT CAGGGAAACGTCTCAGAAGTTCAGTAACTTGTTTTGATGATAATCGATTAAATCGGTCTACGAGAACTGTCAGTAGGTGA TACAATTTCTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1478585: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785852804081AA756911MF4MA153.AF3S. mansoni female adult Lambda Zap


Date: 8:40:17 on Fri 24 Nov 117.